pastoris strain X-33 by electroporation, and grown on the Yeast Extract Peptone Dextrose (YPDS) medium agar plates at 30 ☌ for four days. The isolated plasmids were linearised with PmeI, transformed into sorbitol-treated P. The constructs were transformed into chemically competent Escherichia coli DH5α cells to produce ∼ 10 μg of the plasmid. Mutants E256K (forward primer 5′ CAATTCCCTCAACAAGGCGACGATGGTGCTGG 3′ reverse primer 5′ CCAGCACCATCGTCGCCTTGTTGAGGGAATTG 3′) and R457W (forward primer 5′ TGGATTGTGGACTGGACCACCACGGTGGTGAA 3′, reverse primer 5′ TTCACCACCGTGGTGGTCCAGTCCACAATCCA 3′) were introduced using QuickChange site-directed mutagenesis on the ordered pPICZ-B vector with the inserted human wild-type ASCT1 gene. The pPICZ-B vector with incorporated human wild-type ASCT1 gene was ordered from GenScript. To be able to map these mutations and get a better understanding how they lead to the malfunctioning of this transporter, we solved the ASCT1 structure using single-particle cryo-EM technique to the overall resolution of 4.2 Å and performed subsequent all-atom molecular dynamics (MD) simulations on the aforementioned missense mutations as well as their functional characterization. Up to date characterized nonsense mutations are Y191* (so only a partial scaffold domain and almost none of a transport domain produced), which leads to microcephaly, tonic-clonic seizures, motor and speech delays W453* (almost complete protein produced, except TM8 and C-terminus), leading to microcephaly, motor and dyscognitive seizures, speech delay one frame shift mutation 元15*fs (hence the transport domain does not follow the canonical sequence), causing microcephaly, infantile spasms, speech delay and three missense mutations – E256K, G381R, R457W, leading to various degrees of similar disorders and disabilities, ,. Įxperiments on ASCT1-knock out mice revealed numerous motor and neurodevelopmental disorders similar to those linked to nonsense and missense mutations in ASCT1 in humans (recently reviewed in ), which cause autosomal recessive neurodevelopmental disorders, generally termed as spastic tetraplegia, thin corpus callosum, and progressive microcephaly (SPATCCM, Online Mendelian Inheritance in Man # 616657). Interestingly, both ASCT1 and ASCT2 were shown to transport L-Ser and D-Ser in transfected HEK293 cells, , hence perhaps there is an interplay between two transporters with the preferential expression of ASCT1 in astrocytes, and ASCT2 in neurons. However the synthesis of L-Ser is confined to astrocytes, hence it must be somehow shuttled to serine racemase (so-called serine shuttle ), and the major role in L-Ser transport is ascribed to ASCT1, which is capable to exchange L-Ser for D-Ser or any other suitable substrate.
D-Ser is a major co-agonist of N-methyl-D-aspartate receptors, produced by racemization of L-Ser by the specific enzyme serine racemase, which is heavily expressed in neurons, and to some extent in glial cells. L-Ser is a non-essential amino acid, however there is an active de novo synthesis of L-Ser in the brain as it is a critical precursor for the synthesis of L-Cys, phosphatidyl-L-Ser, sphingolipids, and most importantly of D-Ser. Up to date ASCT1 was associated only with esophageal adenocarcinomas and prostate cancer, albeit it was shown that ASCT1 is not capable to transport glutamine. ASCT2 has gained a lot of focus since it has been linked to numerous cancers (see recent reviews, ) where it is involved into the transport of glutamine, which is essential for carcinogenesis as it can be used to fuel the TCA cycle. ASCTs are ubiquitously expressed with the highest expression of ASCT2 in placenta, lung, skeletal muscle, kidney, pancreas, and intestine and of ASCT1 in brain, muscle, and pancreas,. There is still no consensus whether the transport is electroneutral (this work and, ) or electrogenic (discussed in ). ĪSCT proteins, in contrast, do not concentrate their substrates, but perform the obligatory exchange of the amino acid pools, although the transport is still coupled to Na +. The transport is also coupled to H + and counter-transport of K + ion, ,, and additionally all transporters reveal different levels of uncoupled chloride conductance, ,. EAATs use the sodium gradient as an energy source to re-uptake the neurotransmitter glutamate (as well as L- or D-aspartate) in the synaptic cleft to prevent the overstimulation of glutamate receptors and avoid excitotoxicity. Alanine Serine Cysteine Transporter 1 (ASCT1) belongs to the solute carrier 1 family (SLC1) of proteins, which includes the subfamily of Excitatory Amino Acid Transporters (EAAT1-5) and another neutral amino acid exchanger, ASCT2.
0 kommentar(er)
